NerdTalk

OK people. We wanted to let you know how things sound and feel like in the lab. So this one is for those of you who are interested, have a little more background knowledge, or are scientists. These are some notes on what exactly we did to sequence LilBUB’s ZRS in a way that I’d write it in an email to Uschi or Dario or how I could reconstruct the experiment I did in my lab book. I amplified 2.8kb surrounding the 800bp ZRS (fwd_primer: CCTTGAAGTGGAAATCTCTCCTG rev_primer: ATCAATTGCGTGAAAACTGCAAGGG) to not only get the conserved 800 bp, but also another highly conserved 300bp just next to the ZRS. I also didn’t sequence the PCR product, but subcloned it into a pTA-vector and sequenced four individual clones. That way I can reconstruct both alleles separately and don’t have the allele-mix in the PCR-product. I sequenced all 2.7kb of four individual clones with 6 sequencing primers (I’ll paste the seq below). I decided to do it that way so that I can maybe have some SNPs in the non-conserved region surrounding the ZRS to make sure I really got both alleles in the four clones I sequenced. Best – Daniel Sequencing Primers

catZRSeq1 TTGATGGGGTTTTCCTCGAAC
catZRSeq2 TCAGCTTTATAGGCCTTCCCAG
catZRSeq3 CAAGACGCAAACCGCGGAG
catZRSeq4R GGGCGGATGCAGAGCTTG
catZRSeq5 ttagtgagatatgagtccattttctgt
catZRSeq6R gagcatagcacacggtct

And this (the one on the very right) is the PCR machine that I used for the PCR and the sequencing reaction.

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s